Product Details

SNP ID: rs200801879
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:6427126 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACCTTGGGCCTGCATCCTGGTGCGC[A/G]CCAGAGTCAGTGGGTAGCTGGCCAT
Phenotype: MIM: 603445 MIM: 608746 MIM: 610822
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: KHSRP PubMed Links

Gene Details

Gene: KHSRP
Gene Name: KH-type splicing regulatory protein

There are no transcripts associated with this gene.

Gene: SLC25A23
Gene Name: solute carrier family 25 member 23

There are no transcripts associated with this gene.

Gene: SLC25A41
Gene Name: solute carrier family 25 member 41

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001321298.1	797	Missense Mutation	GCG,GTG	A168V	NP_001308227.1
NM_173637.3	797	Missense Mutation	GCG,GTG	A306V	NP_775908.2
XM_011527926.1	797	Missense Mutation	GCG,GTG	A242V	XP_011526228.1

View Full Product Details