Product Details

SNP ID: rs200703160
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:1816110 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCTTCTCGAACCTTCCAGATCACCA[A/G]GTGCATGCAGGCGCCGGCGTCCTCG
Phenotype: MIM: 605866 MIM: 615201 MIM: 609614
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ATP8B3 PubMed Links

Gene Details

Gene: ATP8B3
Gene Name: ATPase phospholipid transporting 8B3

There are no transcripts associated with this gene.

Gene: LOC100288123
Gene Name: uncharacterized LOC100288123

There are no transcripts associated with this gene.

Gene: MIR1909
Gene Name: microRNA 1909

There are no transcripts associated with this gene.

Gene: REXO1
Gene Name: RNA exonuclease 1 homolog

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_020695.3	3822	Silent Mutation	CTG,TTG	L1208L	NP_065746.3
XM_011528144.1	3822	Missense Mutation	CCT,CTT	P1240L	XP_011526446.1
XM_011528146.2	3822	Missense Mutation	CCT,CTT	P1205L	XP_011526448.1
XM_017027028.1	3822	Missense Mutation	CCT,CTT	P1231L	XP_016882517.1
XM_017027029.1	3822	Silent Mutation	CTG,TTG	L1217L	XP_016882518.1
XM_017027030.1	3822	Intron			XP_016882519.1

View Full Product Details