Product Details

SNP ID: rs201755779
Assay Type: Functionally tested
NCBI dbSNP Submissions: 3
Location: Chr.1:25823727 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTGGGACCAACCTACCCTTGAAGCC[A/G]TGTGCCCGGGCGTCCTTTGAGGTGA
Phenotype: MIM: 606210
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: AUNIP PubMed Links

Gene Details

Gene: AUNIP
Gene Name: aurora kinase A and ninein interacting protein

There are no transcripts associated with this gene.

Gene: LOC646471
Gene Name: uncharacterized LOC646471

There are no transcripts associated with this gene.

Gene: MTFR1L
Gene Name: mitochondrial fission regulator 1 like

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001099625.1	318	Silent Mutation	CCA,CCG	P36P	NP_001093095.1
NM_001099626.1	318	Silent Mutation	CCA,CCG	P36P	NP_001093096.1
NM_001099627.1	318	Silent Mutation	CCA,CCG	P36P	NP_001093097.1
NM_019557.5	318	Silent Mutation	CCA,CCG	P36P	NP_062457.3

Gene: SEPN1
Gene Name: selenoprotein N, 1

There are no transcripts associated with this gene.

View Full Product Details