Product Details

SNP ID: rs199684527
Assay Type: Functionally tested
NCBI dbSNP Submissions: 2
Location: Chr.1:155256742 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCAGGGCGACCAGCAGCATGAGCA[C/T]GGATACTGCTGTGTTGCCCTTCGGC
Phenotype: MIM: 602989 MIM: 606913
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CLK2 PubMed Links

Gene Details

Gene: CLK2
Gene Name: CDC like kinase 2

There are no transcripts associated with this gene.

Gene: FAM189B
Gene Name: family with sequence similarity 189 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267608.1	985	Intron			NP_001254537.1
NM_006589.2	985	Intron			NP_006580.2
NM_198264.1	985	Intron			NP_937995.1

Gene: SCAMP3
Gene Name: secretory carrier membrane protein 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005698.3	985	Missense Mutation	ATG,GTG	M277V	NP_005689.2
NM_052837.2	985	Missense Mutation	ATG,GTG	M251V	NP_443069.1
XM_006711105.3	985	Missense Mutation	ATG,GTG	M263V	XP_006711168.1
XM_006711106.3	985	Missense Mutation	ATG,GTG	M210V	XP_006711169.1
XM_016999991.1	985	Silent Mutation	CCA,CCG	P189P	XP_016855480.1

View Full Product Details