Product Details

SNP ID: rs200092801
Assay Type: Functionally tested
NCBI dbSNP Submissions: 19
Location: Chr.1:46673367 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGTCTCCTATCCTTTGGCCACCTGT[C/T]CTGAAAGGAATGTTCTCTTCCATTC
Phenotype: MIM: 608917
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ATPAF1 PubMed Links

Gene Details

Gene: ATPAF1
Gene Name: ATP synthase mitochondrial F1 complex assembly factor 1

There are no transcripts associated with this gene.

Gene: EFCAB14
Gene Name: EF-hand calcium binding domain 14

There are no transcripts associated with this gene.

Gene: EFCAB14-AS1
Gene Name: EFCAB14 antisense RNA 1

There are no transcripts associated with this gene.

Gene: TEX38
Gene Name: testis expressed 38

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145474.3	634	Missense Mutation	CCT,TCT	P178S	NP_001138946.1
NM_001300863.1	634	Missense Mutation	CCT,TCT	P124S	NP_001287792.1
NM_001300864.1	634	Missense Mutation	CCT,TCT	P102S	NP_001287793.1
XM_011541421.2	634	Missense Mutation	CCT,TCT	P179S	XP_011539723.1

View Full Product Details