Product Details

SNP ID: rs199940612
Assay Type: Functionally tested
NCBI dbSNP Submissions: 11
Location: Chr.1:1203897 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTCTCCTCTGCCGATCGCTCGCCCC[A/G]CTCTTCCTCGGGGAACTGGCAGCTT
Phenotype: MIM: 603905 MIM: 600315
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: TNFRSF18 PubMed Links

Gene Details

Gene: TNFRSF18
Gene Name: TNF receptor superfamily member 18

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004195.2	790	Missense Mutation			NP_004186.1
NM_148901.1	790	Silent Mutation			NP_683699.1
NM_148902.1	790	Missense Mutation			NP_683700.1
XM_017002722.1	790	Silent Mutation			XP_016858211.1

Gene: TNFRSF4
Gene Name: TNF receptor superfamily member 4

There are no transcripts associated with this gene.

Gene: TTLL10
Gene Name: tubulin tyrosine ligase like 10

There are no transcripts associated with this gene.

View Full Product Details