Product Details
- SNP ID
-
rs200715713
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
4
- Location
-
Chr.1:153418193 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AGCCAAGCCTGCTGACGATGATGAA[A/G]GAGAACTTCCCCAATTTCCTCAGTG
- Phenotype
-
MIM: 123885
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
S100A7A
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs35867643] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- S100A7A
- Gene Name
- S100 calcium binding protein A7A
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_176823.3 |
|
Intron |
|
|
NP_789793.1 |
- Gene
- S100A8
- Gene Name
- S100 calcium binding protein A8
View Full Product Details