Product Details

SNP ID: rs200358223
Assay Type: Functionally tested
NCBI dbSNP Submissions: 3
Location: Chr.1:15737961 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGCAGCTGCAAGCTCAGACAGTGGC[C/T]GCAGTGGCCGTGGGACACCAGCACA
Phenotype: MIM: 609613 MIM: 610817
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: PLEKHM2 PubMed Links

Gene Details

Gene: PLEKHM2
Gene Name: pleckstrin homology and RUN domain containing M2

There are no transcripts associated with this gene.

Gene: SLC25A34
Gene Name: solute carrier family 25 member 34

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_207348.2	1809	Silent Mutation	GCC,GCT	A137A	NP_997231.1
XM_011541292.2	1809	Silent Mutation	GCC,GCT	A137A	XP_011539594.1
XM_011541293.1	1809	Silent Mutation	GCC,GCT	A137A	XP_011539595.1
XM_017001083.1	1809	Silent Mutation	GCC,GCT	A137A	XP_016856572.1

Gene: TMEM82
Gene Name: transmembrane protein 82

There are no transcripts associated with this gene.

View Full Product Details