Product Details

SNP ID

rs200743154

Assay Type

Functionally tested

NCBI dbSNP Submissions

3

Location

Chr.1:161167124 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

GGTGGTCCTAGTGGAGAGCAGTGAG[C/T]GTCTGGGAGGCTGGATTCGCTCCGT

Phenotype

MIM: 604014 MIM: 600923 MIM: 610554 MIM: 604729

Polymorphism

C/T, Transition substitution

Allele Nomenclature

Literature Links

B4GALT3 PubMed Links

Gene Details

Gene

B4GALT3

Gene Name

beta-1,4-galactosyltransferase 3

There are no transcripts associated with this gene.

Gene

PPOX

Gene Name

protoporphyrinogen oxidase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000309.3	238	Missense Mutation	CGT,TGT	R38C	NP_000300.1
NM_001122764.1	238	Missense Mutation	CGT,TGT	R38C	NP_001116236.1
XM_005245291.3	238	Missense Mutation	CGT,TGT	R38C	XP_005245348.2
XM_005245295.3	238	UTR 5			XP_005245352.2
XM_006711402.2	238	Missense Mutation	CGT,TGT	R38C	XP_006711465.2
XM_006711403.2	238	Missense Mutation	CGT,TGT	R38C	XP_006711466.2
XM_006711404.3	238	Missense Mutation	CGT,TGT	R76C	XP_006711467.2
XM_006711406.2	238	UTR 5			XP_006711469.2
XM_011509663.2	238	Missense Mutation	CGT,TGT	R76C	XP_011507965.1
XM_011509664.1	238	Missense Mutation	CGT,TGT	R76C	XP_011507966.1
XM_011509665.2	238	Missense Mutation	CGT,TGT	R76C	XP_011507967.1
XM_011509666.2	238	Missense Mutation	CGT,TGT	R76C	XP_011507968.1
XM_011509667.2	238	Missense Mutation	CGT,TGT	R38C	XP_011507969.1
XM_011509668.2	238	Missense Mutation	CGT,TGT	R38C	XP_011507970.1
XM_011509669.1	238	Missense Mutation	CGT,TGT	R38C	XP_011507971.1
XM_011509670.2	238	Missense Mutation	CGT,TGT	R76C	XP_011507972.1
XM_011509671.1	238	Missense Mutation	CGT,TGT	R76C	XP_011507973.1
XM_011509672.2	238	Missense Mutation	CGT,TGT	R76C	XP_011507974.1
XM_011509673.2	238	Missense Mutation	CGT,TGT	R76C	XP_011507975.1
XM_011509674.2	238	Missense Mutation	CGT,TGT	R76C	XP_011507976.1
XM_011509675.2	238	Missense Mutation	CGT,TGT	R38C	XP_011507977.1
XM_011509676.1	238	UTR 5			XP_011507978.1
XM_011509677.1	238	UTR 5			XP_011507979.1
XM_011509678.1	238	UTR 5			XP_011507980.1
XM_011509679.1	238	UTR 5			XP_011507981.1
XM_011509681.1	238	UTR 5			XP_011507983.1
XM_011509682.1	238	UTR 5			XP_011507984.1
XM_017001559.1	238	Missense Mutation	CGT,TGT	R76C	XP_016857048.1
XM_017001560.1	238	Missense Mutation	CGT,TGT	R38C	XP_016857049.1
XM_017001561.1	238	UTR 5			XP_016857050.1
XM_017001562.1	238	UTR 5			XP_016857051.1
XM_017001563.1	238	UTR 5			XP_016857052.1
XM_017001564.1	238	Intron			XP_016857053.1
XM_017001565.1	238	UTR 5			XP_016857054.1
XM_017001566.1	238	UTR 5			XP_016857055.1
XM_017001567.1	238	UTR 5			XP_016857056.1
XM_017001568.1	238	UTR 5			XP_016857057.1
XM_017001569.1	238	UTR 5			XP_016857058.1
XM_017001570.1	238	UTR 5			XP_016857059.1
XM_017001571.1	238	Missense Mutation	CGT,TGT	R76C	XP_016857060.1

Gene

UFC1

Gene Name

ubiquitin-fold modifier conjugating enzyme 1

There are no transcripts associated with this gene.

Gene

USP21

Gene Name

ubiquitin specific peptidase 21

There are no transcripts associated with this gene.

View Full Product Details