Product Details

SNP ID: rs202211100
Assay Type: Functionally tested
NCBI dbSNP Submissions: 2
Location: Chr.1:37807112 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAAACTTGACTCACAGGCGTAAAAG[C/G]GTTTAGGTCCTTGTTGAGCTCCTCC
Phenotype: MIM: 600172 MIM: 612276
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: C1orf122 PubMed Links

Gene Details

Gene: C1orf122
Gene Name: chromosome 1 open reading frame 122

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001142726.1	506	Intron			NP_001136198.1
NM_198446.2	506	Intron			NP_940848.2

Gene: MANEAL
Gene Name: mannosidase endo-alpha like

There are no transcripts associated with this gene.

Gene: MTF1
Gene Name: metal regulatory transcription factor 1

There are no transcripts associated with this gene.

Gene: YRDC
Gene Name: yrdC N6-threonylcarbamoyltransferase domain containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024640.3	506	Missense Mutation	CCT,GCT	P165A	NP_078916.3

View Full Product Details