Product Details

SNP ID: rs199696926
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.20:35280670 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTGCCTCACCCTGTCCAAGTCTGGG[C/T]GGACCAAGGCCACGTAGTCATTGCA
Phenotype: MIM: 602912 MIM: 604871
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: EIF6 PubMed Links

Gene Details

Gene: EIF6
Gene Name: eukaryotic translation initiation factor 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001267810.1	583	Missense Mutation	CAC,CGC	H118R	NP_001254739.1
NM_002212.3	583	Missense Mutation	CAC,CGC	H118R	NP_002203.1
NM_181466.2	583	Intron			NP_852131.1
NM_181468.2	583	Missense Mutation	CAC,CGC	H118R	NP_852133.1

Gene: FAM83C
Gene Name: family with sequence similarity 83 member C

There are no transcripts associated with this gene.

Gene: FAM83C-AS1
Gene Name: FAM83C antisense RNA 1

There are no transcripts associated with this gene.

Gene: MMP24
Gene Name: matrix metallopeptidase 24

There are no transcripts associated with this gene.

Gene: MMP24-AS1
Gene Name: MMP24 antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details