Product Details
- SNP ID
-
rs199610377
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.21:30496973 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- CATAGCATGATGGGCGGCAGTAGCC[A/G]TATCCGTTGCCTCCAAAGCCACAGC
- Phenotype
-
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
KRTAP19-2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs2298437] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- KRTAP19-2
- Gene Name
- keratin associated protein 19-2
There are no transcripts associated with this gene.
- Gene
- KRTAP19-3
- Gene Name
- keratin associated protein 19-3
There are no transcripts associated with this gene.
- Gene
- KRTAP19-4
- Gene Name
- keratin associated protein 19-4
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_181610.1 |
138 |
Silent Mutation |
TAC,TAT |
Y46Y |
NP_853641.1 |
- Gene
- KRTAP19-5
- Gene Name
- keratin associated protein 19-5
There are no transcripts associated with this gene.
View Full Product Details