Product Details
- SNP ID
-
rs201685920
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.22:50447340 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GGCTCACGTCAAAGAAGGCCTTCTC[A/G]TCCACAGTCTTAGGGGCACCCATAG
- Phenotype
-
MIM: 610877
MIM: 603560
- Polymorphism
- A/G, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
PPP6R2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs192771726] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- PPP6R2
- Gene Name
- protein phosphatase 6 regulatory subunit 2
There are no transcripts associated with this gene.
- Gene
- SBF1
- Gene Name
- SET binding factor 1
View Full Product Details