Product Details

SNP ID
rs200594216
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.2:241735327 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
GCCGGTTGGCCCCCTGGCCCGCAGA[A/G]GCTGCTGCTCCGCCCCGGGGACCCC
Phenotype
MIM: 609186 MIM: 608525
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
D2HGDH PubMed Links

Gene Details

Gene
D2HGDH
Gene Name
D-2-hydroxyglutarate dehydrogenase
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001287249.1 263 Intron NP_001274178.1
NM_152783.4 263 Missense Mutation AGC,GGC S35G NP_689996.4
XM_011511734.1 263 Missense Mutation AGC,GGC S35G XP_011510036.1
XM_011511735.1 263 Missense Mutation AGC,GGC S35G XP_011510037.1
XM_011511736.1 263 Missense Mutation AGC,GGC S35G XP_011510038.1
XM_011511737.2 263 Missense Mutation AGC,GGC S35G XP_011510039.1
XM_011511738.2 263 Missense Mutation AGC,GGC S35G XP_011510040.1
XM_011511739.1 263 Missense Mutation AGC,GGC S35G XP_011510041.1
XM_011511740.2 263 Missense Mutation AGC,GGC S35G XP_011510042.1
XM_011511741.2 263 Missense Mutation AGC,GGC S35G XP_011510043.1
XM_011511743.1 263 Missense Mutation AGC,GGC S35G XP_011510045.1
XM_011511744.1 263 Missense Mutation AGC,GGC S35G XP_011510046.1
XM_011511745.2 263 Missense Mutation AGC,GGC S35G XP_011510047.1
XM_011511746.2 263 Missense Mutation AGC,GGC S35G XP_011510048.1
XM_011511747.2 263 Missense Mutation AGC,GGC S35G XP_011510049.1
XM_011511749.2 263 Missense Mutation AGC,GGC S35G XP_011510051.1
XM_011511750.2 263 Missense Mutation AGC,GGC S35G XP_011510052.1
XM_011511751.1 263 Missense Mutation AGC,GGC S35G XP_011510053.1
XM_011511752.1 263 Missense Mutation AGC,GGC S35G XP_011510054.1
XM_011511753.2 263 Missense Mutation AGC,GGC S35G XP_011510055.1
XM_011511754.1 263 Intron XP_011510056.1
XM_011511756.1 263 Missense Mutation AGC,GGC S35G XP_011510058.1
XM_011511757.2 263 Missense Mutation AGC,GGC S35G XP_011510059.1
XM_011511758.2 263 Missense Mutation AGC,GGC S35G XP_011510060.1
XM_011511759.2 263 Missense Mutation AGC,GGC S35G XP_011510061.1
XM_011511760.2 263 Missense Mutation AGC,GGC S35G XP_011510062.1
XM_017004827.1 263 Missense Mutation AGC,GGC S35G XP_016860316.1
XM_017004828.1 263 Missense Mutation AGC,GGC S35G XP_016860317.1
XM_017004829.1 263 Missense Mutation AGC,GGC S35G XP_016860318.1
XM_017004830.1 263 Missense Mutation AGC,GGC S35G XP_016860319.1
XM_017004831.1 263 UTR 5 XP_016860320.1
XM_017004832.1 263 Missense Mutation AGC,GGC S35G XP_016860321.1
Gene
ING5
Gene Name
inhibitor of growth family member 5
There are no transcripts associated with this gene.

View Full Product Details