Product Details

SNP ID: rs200025668
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:55234194 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GATGGACGTACTTTGTCTGACTACA[A/G]TATTCAAAAGGTCTGTCTAGGGGAA
Phenotype: MIM: 603766 MIM: 191343
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CLHC1 PubMed Links

Gene Details

Gene: CLHC1
Gene Name: clathrin heavy chain linker domain containing 1

There are no transcripts associated with this gene.

Gene: MTIF2
Gene Name: mitochondrial translational initiation factor 2

There are no transcripts associated with this gene.

Gene: RPS27A
Gene Name: ribosomal protein S27a

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001135592.2	402	Missense Mutation	AAT,AGT	N60S	NP_001129064.1
NM_001177413.1	402	Missense Mutation	AAT,AGT	N60S	NP_001170884.1
NM_002954.5	402	Missense Mutation	AAT,AGT	N60S	NP_002945.1

View Full Product Details