Product Details

SNP ID: rs200125673
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:74528887 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AACTCCCCCCGCCCATTCATCTCCA[G/T]GAAGCCCCGAGACCAGCACACAAAG
Phenotype: MIM: 602434 MIM: 606441 MIM: 607163
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: AUP1 PubMed Links

Gene Details

Gene: AUP1
Gene Name: ancient ubiquitous protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_181575.4	601	Missense Mutation			NP_853553.1
XM_005264392.3	601	Missense Mutation			XP_005264449.1

Gene: DQX1
Gene Name: DEAQ-box RNA dependent ATPase 1

There are no transcripts associated with this gene.

Gene: HTRA2
Gene Name: HtrA serine peptidase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001321727.1	601	Intron			NP_001308656.1
NM_001321728.1	601	Intron			NP_001308657.1
NM_013247.4	601	Intron			NP_037379.1
NM_145074.2	601	Intron			NP_659540.1

Gene: LOXL3
Gene Name: lysyl oxidase like 3

There are no transcripts associated with this gene.

View Full Product Details