Product Details

SNP ID: rs201475092
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:219163395 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCTTCCCTTCCACCTACCTGTGCT[A/G]AACAGGACTGGGGCTTCCCGAAACC
Phenotype: MIM: 611290
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CNPPD1 PubMed Links

Gene Details

Gene: CNPPD1
Gene Name: cyclin Pas1/PHO80 domain containing 1

There are no transcripts associated with this gene.

Gene: NHEJ1
Gene Name: non-homologous end joining factor 1

There are no transcripts associated with this gene.

Gene: SLC23A3
Gene Name: solute carrier family 23 member 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001144889.1	1194	Silent Mutation	TTC,TTT	F478F	NP_001138361.1
NM_001144890.1	1194	Silent Mutation	TTC,TTT	F486F	NP_001138362.1
NM_144712.4	1194	Silent Mutation	TTC,TTT	F361F	NP_653313.3

View Full Product Details