Product Details

SNP ID: rs199519128
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:51977931 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGCCCTGCTGGGCCTGAGTCTGCTG[C/T]TCATGCTCCTACTGTATGTGGGGCT
Phenotype: MIM: 104620
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ABHD14A PubMed Links

Gene Details

Gene: ABHD14A
Gene Name: abhydrolase domain containing 14A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_015407.4	240	Missense Mutation	CTC,TTC	L44F	NP_056222.2

Gene: ABHD14A-ACY1
Gene Name: ABHD14A-ACY1 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001316331.1	240	UTR 5			NP_001303260.1

Gene: ABHD14B
Gene Name: abhydrolase domain containing 14B

There are no transcripts associated with this gene.

Gene: ACY1
Gene Name: aminoacylase 1

There are no transcripts associated with this gene.

View Full Product Details