Product Details

SNP ID: rs200439690
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:50296844 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCTGTGGGGAAGGCATTAAGCAGG[C/G]TGGCAGGCAGCCGTCTGCTGGTGAA
Phenotype: MIM: 607071 MIM: 604038 MIM: 602725 MIM: 607073
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: HYAL1 PubMed Links

Gene Details

Gene: HYAL1
Gene Name: hyaluronoglucosaminidase 1

There are no transcripts associated with this gene.

Gene: HYAL3
Gene Name: hyaluronoglucosaminidase 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001200029.1	753	Intron			NP_001186958.1
NM_001200030.1	753	Intron			NP_001186959.1
NM_001200031.1	753	Intron			NP_001186960.1
NM_001200032.1	753	Intron			NP_001186961.1
NM_003549.3	753	Intron			NP_003540.2

Gene: IFRD2
Gene Name: interferon related developmental regulator 2

There are no transcripts associated with this gene.

Gene: LSMEM2
Gene Name: leucine rich single-pass membrane protein 2

There are no transcripts associated with this gene.

Gene: NAT6
Gene Name: N-acetyltransferase 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001200016.1	753	Missense Mutation	ACC,AGC	T207S	NP_001186945.1
NM_001200018.1	753	Missense Mutation	ACC,AGC	T207S	NP_001186947.1
NM_012191.3	753	Missense Mutation	ACC,AGC	T229S	NP_036323.2

View Full Product Details