Product Details

SNP ID: rs199949354
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:52833625 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCATGAGGACACTCACCACACTCT[C/T]GCATGACCTGGTAGGTCTTGGACTT
Phenotype: MIM: 600564
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ITIH4 PubMed Links

Gene Details

Gene: ITIH4
Gene Name: inter-alpha-trypsin inhibitor heavy chain family member 4

There are no transcripts associated with this gene.

Gene: ITIH4-AS1
Gene Name: ITIH4 antisense RNA 1

There are no transcripts associated with this gene.

Gene: MUSTN1
Gene Name: musculoskeletal, embryonic nuclear protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_205853.3	1135	Missense Mutation	CAA,CGA	Q45R	NP_995325.3

Gene: TMEM110
Gene Name: transmembrane protein 110

There are no transcripts associated with this gene.

Gene: TMEM110-MUSTN1
Gene Name: TMEM110-MUSTN1 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001198974.2	1135	Missense Mutation	CAA,CGA	Q335R	NP_001185903.2

View Full Product Details