Product Details

SNP ID: rs200320319
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:1718325 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGTAGGTGGTTACCTTCATCACCCA[C/T]GTGTCTGTCACAATCACACGGGCAC
Phenotype: MIM: 602422 MIM: 605303 MIM: 615975
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: SLBP PubMed Links

Gene Details

Gene: SLBP
Gene Name: stem-loop binding protein

There are no transcripts associated with this gene.

Gene: TACC3
Gene Name: transforming acidic coiled-coil containing protein 3

There are no transcripts associated with this gene.

Gene: TMEM129
Gene Name: transmembrane protein 129

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001127266.1	1027	Silent Mutation	ACA,ACG	T169T	NP_001120738.1
NM_138385.3	1027	Silent Mutation	ACA,ACG	T169T	NP_612394.1
XM_005248038.4	1027	Silent Mutation	ACA,ACG	T96T	XP_005248095.1
XM_005248039.4	1027	Silent Mutation	ACA,ACG	T96T	XP_005248096.1
XM_011513594.2	1027	Silent Mutation	ACA,ACG	T96T	XP_011511896.1
XM_017008834.1	1027	Silent Mutation	ACA,ACG	T96T	XP_016864323.1

View Full Product Details