Product Details

SNP ID: hCV191451397
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:140967255 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTCAGGTAAGCGAATCGGTGGCGCC[C/T]GGAGCGCGCTTTCACATAGAGAGTG
Phenotype: MIM: 606307 MIM: 606316 MIM: 606317 MIM: 606318 MIM: 606319 MIM: 606308 MIM: 606309 MIM: 606310 MIM: 606311 MIM: 606312 MIM: 606313 MIM: 606314 MIM: 606315 MIM: 606320 MIM: 606321
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: PCDHA1 PubMed Links

Gene Details

Gene: PCDHA1
Gene Name: protocadherin alpha 1

There are no transcripts associated with this gene.

Gene: PCDHA10
Gene Name: protocadherin alpha 10

There are no transcripts associated with this gene.

Gene: PCDHA11
Gene Name: protocadherin alpha 11

There are no transcripts associated with this gene.

Gene: PCDHA12
Gene Name: protocadherin alpha 12

There are no transcripts associated with this gene.

Gene: PCDHA13
Gene Name: protocadherin alpha 13

There are no transcripts associated with this gene.

Gene: PCDHA2
Gene Name: protocadherin alpha 2

There are no transcripts associated with this gene.

Gene: PCDHA3
Gene Name: protocadherin alpha 3

There are no transcripts associated with this gene.

Gene: PCDHA4
Gene Name: protocadherin alpha 4

There are no transcripts associated with this gene.

Gene: PCDHA5
Gene Name: protocadherin alpha 5

There are no transcripts associated with this gene.

Gene: PCDHA6
Gene Name: protocadherin alpha 6

There are no transcripts associated with this gene.

Gene: PCDHA7
Gene Name: protocadherin alpha 7

There are no transcripts associated with this gene.

Gene: PCDHA8
Gene Name: protocadherin alpha 8

There are no transcripts associated with this gene.

Gene: PCDHA9
Gene Name: protocadherin alpha 9

There are no transcripts associated with this gene.

Gene: PCDHAC1
Gene Name: protocadherin alpha subfamily C, 1

There are no transcripts associated with this gene.

Gene: PCDHAC2
Gene Name: protocadherin alpha subfamily C, 2

There are no transcripts associated with this gene.

View Full Product Details