Product Details

SNP ID: rs200051899
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:140547817 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TGCTACAGCACCACGCCGGGGGGCA[A/C]GCTATACGCCACTACCCCCGGAGGT
Phenotype: MIM: 610500 MIM: 603483 MIM: 603819
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: ANKHD1 PubMed Links

Gene Details

Gene: ANKHD1
Gene Name: ankyrin repeat and KH domain containing 1

There are no transcripts associated with this gene.

Gene: ANKHD1-EIF4EBP3
Gene Name: ANKHD1-EIF4EBP3 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_020690.5	152	Intron			NP_065741.3

Gene: EIF4EBP3
Gene Name: eukaryotic translation initiation factor 4E binding protein 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003732.2	152	Missense Mutation	AAG,ACG	K27T	NP_003723.1

Gene: SRA1
Gene Name: steroid receptor RNA activator 1

There are no transcripts associated with this gene.

View Full Product Details