Product Details
- SNP ID
-
rs200120809
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.5:141945389 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AGGCGTCTGAGGTATGTTCACAGGC[A/T]CCTGCTGCTGCTGCTGCTGCCTCTG
- Phenotype
-
MIM: 615741
MIM: 605622
MIM: 605675
- Polymorphism
- A/T, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
KIAA0141
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs5871792] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- KIAA0141
- Gene Name
- KIAA0141
- Gene
- PCDH12
- Gene Name
- protocadherin 12
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_016580.3 |
4758 |
Missense Mutation |
AGC,TGC |
S1183C |
NP_057664.1 |
- Gene
- RNF14
- Gene Name
- ring finger protein 14
There are no transcripts associated with this gene.
View Full Product Details