Product Details

SNP ID: rs200324612
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:141638246 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCCTCATGTCGGAACCACAGCCTGA[C/T]CTGGAACCGCCCCAACATGGGCTAT
Phenotype: MIM: 605166 MIM: 611213
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FCHSD1 PubMed Links

Gene Details

Gene: FCHSD1
Gene Name: FCH and double SH3 domains 1

There are no transcripts associated with this gene.

Gene: HDAC3
Gene Name: histone deacetylase 3

There are no transcripts associated with this gene.

Gene: RELL2
Gene Name: RELT like 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001130029.1	889	Silent Mutation	GAC,GAT	D7D	NP_001123501.1
NM_173828.4	889	Silent Mutation	GAC,GAT	D7D	NP_776189.3
XM_005268414.3	889	Silent Mutation	GAC,GAT	D7D	XP_005268471.1
XM_011537624.1	889	Silent Mutation	GAC,GAT	D7D	XP_011535926.1
XM_011537625.2	889	Silent Mutation	GAC,GAT	D7D	XP_011535927.1

View Full Product Details