Product Details

SNP ID: rs201021124
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.5:139402025 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTTGGCCAGGAGGACCTTGGTTTT[C/G]GCATGGGCAGCTTTCTCTTCCTGCA
Phenotype
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: DNAJC18 PubMed Links

Gene Details

Gene: DNAJC18
Gene Name: DnaJ heat shock protein family (Hsp40) member C18

There are no transcripts associated with this gene.

Gene: PROB1
Gene Name: proline rich basic protein 1

There are no transcripts associated with this gene.

Gene: SPATA24
Gene Name: spermatogenesis associated 24

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_194296.1	231	Silent Mutation	GCC,GCG	A68A	NP_919272.1
XM_005271916.4	231	Silent Mutation	GCC,GCG	A68A	XP_005271973.1
XM_011543252.2	231	Silent Mutation	GCC,GCG	A29A	XP_011541554.1
XM_011543253.2	231	Silent Mutation	GCC,GCG	A29A	XP_011541555.1
XM_011543254.2	231	Silent Mutation	GCC,GCG	A68A	XP_011541556.1

View Full Product Details