Product Details

SNP ID

rs202187130

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.6:26445972 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TCCTCGGCCTGGAAAAGACAGCCAG[C/T]ATATCCATCGCAGGTCAGTACCCTG

Phenotype

MIM: 613594 MIM: 613595

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

BTN3A2 PubMed Links

Additional Information

For this assay, SNP(s) [rs3846848] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

BTN3A2

Gene Name

butyrophilin subfamily 3 member A2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001197246.2	874	Intron			NP_001184175.1
NM_001197247.2	874	Intron			NP_001184176.1
NM_001197248.2	874	Intron			NP_001184177.1
NM_001197249.2	874	Intron			NP_001184178.1
NM_007047.4	874	Intron			NP_008978.2
XM_005248827.3	874	Intron			XP_005248884.1
XM_005248831.3	874	Intron			XP_005248888.1
XM_005248832.3	874	Intron			XP_005248889.1
XM_006714979.3	874	Intron			XP_006715042.1
XM_006714980.3	874	Intron			XP_006715043.1
XM_006714981.3	874	Intron			XP_006715044.1
XM_006714982.3	874	Intron			XP_006715045.1
XM_011514267.2	874	Intron			XP_011512569.1
XM_011514268.2	874	Intron			XP_011512570.1
XM_011514269.2	874	Intron			XP_011512571.1
XM_011514270.2	874	Intron			XP_011512572.1
XM_011514271.2	874	Intron			XP_011512573.1
XM_017010211.1	874	Intron			XP_016865700.1
XM_017010212.1	874	Intron			XP_016865701.1
XM_017010213.1	874	Intron			XP_016865702.1
XM_017010214.1	874	Intron			XP_016865703.1
XM_017010215.1	874	Intron			XP_016865704.1
XM_017010216.1	874	Intron			XP_016865705.1
XM_017010217.1	874	Intron			XP_016865706.1

Gene

BTN3A3

Gene Name

butyrophilin subfamily 3 member A3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242803.1	874	Intron			NP_001229732.1
NM_006994.4	874	Silent Mutation	AGC,AGT	S234S	NP_008925.1
NM_197974.2	874	Silent Mutation	AGC,AGT	S192S	NP_932078.2

View Full Product Details