Product Details

SNP ID: rs200350126
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:31545491 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGAAGCTGGGCCAGGACACGCTCTC[A/G]GTTTCTCTGCTGGGAGCTCTGCATG
Phenotype: MIM: 606853 MIM: 142560 MIM: 601022
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ATP6V1G2 PubMed Links

Gene Details

Gene: ATP6V1G2
Gene Name: ATPase H+ transporting V1 subunit G2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001204078.1	443	Nonsense Mutation	CGA,TGA	R52*	NP_001191007.1
NM_130463.3	443	Nonsense Mutation	CGA,TGA	R92*	NP_569730.1
NM_138282.2	443	Nonsense Mutation	CGA,TGA	R51*	NP_612139.1

Gene: ATP6V1G2-DDX39B
Gene Name: ATP6V1G2-DDX39B readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: DDX39B
Gene Name: DEAD-box helicase 39B

There are no transcripts associated with this gene.

Gene: DDX39B-AS1
Gene Name: DDX39B antisense RNA 1

There are no transcripts associated with this gene.

Gene: LOC100287329
Gene Name: uncharacterized LOC100287329

There are no transcripts associated with this gene.

Gene: NFKBIL1
Gene Name: NFKB inhibitor like 1

There are no transcripts associated with this gene.

Gene: SNORD117
Gene Name: small nucleolar RNA, C/D box 117

There are no transcripts associated with this gene.

Gene: SNORD84
Gene Name: small nucleolar RNA, C/D box 84

There are no transcripts associated with this gene.

View Full Product Details