Product Details

SNP ID: rs199857326
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:26021923 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACGGAGCACGCCAAGCGCAAGACAG[C/T]CACTGCCATGGACGTGGTCTACGCG
Phenotype: MIM: 142709 MIM: 602810 MIM: 602819 MIM: 602822 MIM: 602829
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: HIST1H1A PubMed Links

Gene Details

Gene: HIST1H1A
Gene Name: histone cluster 1, H1a

There are no transcripts associated with this gene.

Gene: HIST1H3A
Gene Name: histone cluster 1, H3a

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003529.2	245	Intron			NP_003520.1

Gene: HIST1H3B
Gene Name: histone cluster 1, H3b

There are no transcripts associated with this gene.

Gene: HIST1H4A
Gene Name: histone cluster 1, H4a

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003538.3	245	Missense Mutation	GCC,GTC	A82V	NP_003529.1

Gene: HIST1H4B
Gene Name: histone cluster 1, H4b

There are no transcripts associated with this gene.

View Full Product Details