Product Details

SNP ID: rs200115914
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:43517143 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTCTCAGGCGGTGGAGGAAATGCGG[A/G]GCCGCGTGGTTCTGGGGGAGTTTGG
Phenotype: MIM: 610060 MIM: 607845 MIM: 609775
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LRRC73 PubMed Links

Gene Details

Gene: LRRC73
Gene Name: leucine rich repeat containing 73

There are no transcripts associated with this gene.

Gene: POLR1C
Gene Name: RNA polymerase I subunit C

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001318876.1	120	Missense Mutation	AGC,GGC	S12G	NP_001305805.1
NM_203290.3	120	Missense Mutation	AGC,GGC	S12G	NP_976035.1
XM_011515000.2	120	Missense Mutation	AGC,GGC	S12G	XP_011513302.1

Gene: XPO5
Gene Name: exportin 5

There are no transcripts associated with this gene.

Gene: YIPF3
Gene Name: Yip1 domain family member 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_015388.3	120	Intron			NP_056203.2
XM_005248989.4	120	Intron			XP_005249046.1
XM_005248990.2	120	Intron			XP_005249047.1
XM_011514458.2	120	Intron			XP_011512760.1

View Full Product Details