Product Details

SNP ID: rs200501629
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:143291628 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GCTAGCCAAACAGCTGTTGTTGAGC[A/G]AATTGTTAGAACATCTTCTGGAGAA
Phenotype: MIM: 600639 MIM: 616524
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CASP2 PubMed Links

Gene Details

Gene: CASP2
Gene Name: caspase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001224.4	158	Missense Mutation	AAA,GAA	K24E	NP_001215.1
NM_032982.3	158	Missense Mutation	AAA,GAA	K55E	NP_116764.2
NM_032983.3	158	Missense Mutation	AAA,GAA	K55E	NP_116765.2

Gene: LOC105375545
Gene Name: uncharacterized LOC105375545

There are no transcripts associated with this gene.

Gene: TMEM139
Gene Name: transmembrane protein 139

There are no transcripts associated with this gene.

View Full Product Details