Product Details

SNP ID
rs202071453
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.7:99560686 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
GCAGGACACCGACATGGAACAGGGA[C/G]TCACTGGGGGTAAGGCAGAGAAAGC
Phenotype
Polymorphism
C/G, Transversion substitution
Allele Nomenclature
Literature Links
FAM200A PubMed Links

Gene Details

Gene
FAM200A
Gene Name
family with sequence similarity 200 member A
There are no transcripts associated with this gene.

Gene
ZNF655
Gene Name
zinc finger protein 655
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001009958.1 364 Missense Mutation CTC,GTC L43V NP_001009958.1
NM_001009960.1 364 Missense Mutation CTC,GTC L43V NP_001009960.1
NM_001083956.1 364 Missense Mutation CTC,GTC L43V NP_001077425.1
NM_001085366.1 364 Missense Mutation CTC,GTC L43V NP_001078835.1
NM_001085367.1 364 Missense Mutation CTC,GTC L43V NP_001078836.1
NM_001085368.1 364 Missense Mutation CTC,GTC L43V NP_001078837.1
NM_024061.3 364 Missense Mutation CTC,GTC L43V NP_076966.1
NM_138494.2 364 Missense Mutation CTC,GTC L43V NP_612503.1
XM_017012598.1 364 Missense Mutation CTC,GTC L43V XP_016868087.1
XM_017012599.1 364 Missense Mutation CTC,GTC L43V XP_016868088.1
XM_017012600.1 364 Missense Mutation CTC,GTC L43V XP_016868089.1
XM_017012601.1 364 Missense Mutation CTC,GTC L43V XP_016868090.1
XM_017012602.1 364 Missense Mutation CTC,GTC L43V XP_016868091.1
XM_017012603.1 364 Missense Mutation CTC,GTC L43V XP_016868092.1
XM_017012604.1 364 Missense Mutation CTC,GTC L43V XP_016868093.1
XM_017012605.1 364 UTR 5 XP_016868094.1
XM_017012606.1 364 Missense Mutation CTC,GTC L43V XP_016868095.1
XM_017012607.1 364 Missense Mutation CTC,GTC L43V XP_016868096.1
XM_017012608.1 364 UTR 5 XP_016868097.1
XM_017012609.1 364 UTR 5 XP_016868098.1
XM_017012610.1 364 UTR 5 XP_016868099.1
XM_017012611.1 364 Missense Mutation CTC,GTC L43V XP_016868100.1
XM_017012612.1 364 Missense Mutation CTC,GTC L43V XP_016868101.1
XM_017012613.1 364 Missense Mutation CTC,GTC L43V XP_016868102.1

View Full Product Details