Product Details

SNP ID
rs200029471
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.9:137555591 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
GAGCAGCCAGGACCAGTCGGCTCCA[C/T]ACACCAGCGAGTCGGGCAATGTGTG
Phenotype
MIM: 613210 MIM: 611846 MIM: 612122
Polymorphism
C/T, Transition substitution
Allele Nomenclature
Literature Links
DPH7 PubMed Links

Gene Details

Gene
DPH7
Gene Name
diphthamide biosynthesis 7
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_138778.3 975 Missense Mutation TAT,TGT Y336C NP_620133.1
XM_005266123.2 975 Missense Mutation TAT,TGT Y160C XP_005266180.1
XM_005266126.3 975 Missense Mutation TAT,TGT Y160C XP_005266183.1
XM_005266128.2 975 Missense Mutation TAT,TGT Y160C XP_005266185.1
XM_005266129.2 975 Missense Mutation TAT,TGT Y160C XP_005266186.1
XM_005266130.2 975 Missense Mutation TAT,TGT Y160C XP_005266187.1
XM_011519188.1 975 Missense Mutation TAT,TGT Y314C XP_011517490.1
XM_011519189.1 975 Missense Mutation TAT,TGT Y296C XP_011517491.1
XM_011519190.2 975 Intron XP_011517492.1
XM_011519191.2 975 UTR 3 XP_011517493.1
XM_011519192.2 975 Intron XP_011517494.1
XM_011519193.2 975 UTR 3 XP_011517495.1
XM_011519194.1 975 Intron XP_011517496.1
XM_011519199.2 975 Missense Mutation TAT,TGT Y160C XP_011517501.1
XM_011519200.1 975 Missense Mutation TAT,TGT Y160C XP_011517502.1
XM_017015289.1 975 UTR 3 XP_016870778.1
XM_017015290.1 975 UTR 3 XP_016870779.1
XM_017015291.1 975 Missense Mutation TAT,TGT Y160C XP_016870780.1
XM_017015292.1 975 Missense Mutation TAT,TGT Y160C XP_016870781.1
XM_017015293.1 975 Missense Mutation TAT,TGT Y160C XP_016870782.1
XM_017015294.1 975 Missense Mutation TAT,TGT Y160C XP_016870783.1
XM_017015295.1 975 Missense Mutation TAT,TGT Y160C XP_016870784.1
XM_017015296.1 975 Missense Mutation TAT,TGT Y160C XP_016870785.1
XM_017015297.1 975 Missense Mutation TAT,TGT Y160C XP_016870786.1
XM_017015298.1 975 Missense Mutation TAT,TGT Y160C XP_016870787.1
XM_017015299.1 975 Missense Mutation TAT,TGT Y160C XP_016870788.1
XM_017015300.1 975 Missense Mutation TAT,TGT Y160C XP_016870789.1
XM_017015301.1 975 Missense Mutation TAT,TGT Y160C XP_016870790.1
XM_017015302.1 975 Missense Mutation TAT,TGT Y160C XP_016870791.1
XM_017015303.1 975 Missense Mutation TAT,TGT Y160C XP_016870792.1
XM_017015304.1 975 Missense Mutation TAT,TGT Y160C XP_016870793.1
XM_017015305.1 975 Missense Mutation TAT,TGT Y138C XP_016870794.1
XM_017015306.1 975 Missense Mutation TAT,TGT Y138C XP_016870795.1
XM_017015307.1 975 Missense Mutation TAT,TGT Y138C XP_016870796.1
XM_017015308.1 975 Missense Mutation TAT,TGT Y138C XP_016870797.1
XM_017015309.1 975 Missense Mutation TAT,TGT Y138C XP_016870798.1
Gene
MRPL41
Gene Name
mitochondrial ribosomal protein L41
There are no transcripts associated with this gene.

Gene
PNPLA7
Gene Name
patatin like phospholipase domain containing 7
There are no transcripts associated with this gene.

View Full Product Details