Product Details

SNP ID: rs201519044
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:108942781 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCCAAAAGCTTCTCAAGTTTTACT[A/C]TCCATAGTGTCCTTATTTGTAACTG
Phenotype: MIM: 604785 MIM: 603722
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: CTNNAL1 PubMed Links

Gene Details

Gene: CTNNAL1
Gene Name: catenin alpha like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286974.1	2382	UTR 3			NP_001273903.1
NM_003798.3	2382	Missense Mutation	GAG,GAT	E731D	NP_003789.1
XM_005252291.3	2382	Missense Mutation	GAG,GAT	E729D	XP_005252348.1
XM_017015250.1	2382	Missense Mutation	GAG,GAT	E554D	XP_016870739.1
XM_017015251.1	2382	Missense Mutation	GAG,GAT	E552D	XP_016870740.1

Gene: FAM206A
Gene Name: family with sequence similarity 206 member A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017832.3	2382	Intron			NP_060302.1
XM_011518816.2	2382	Intron			XP_011517118.1

Gene: IKBKAP
Gene Name: inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein

There are no transcripts associated with this gene.

View Full Product Details