Product Details

SNP ID: rs201963962
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:154766249 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCATTAATCTTGACAAGCCCTCTAA[C/T]CCCTCTTCCCATGAGGTGGTAGCCT
Phenotype: MIM: 300126
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: DKC1 PubMed Links

Gene Details

Gene: DKC1
Gene Name: dyskerin pseudouridine synthase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001142463.2	521	Silent Mutation	AAC,AAT	N99N	NP_001135935.1
NM_001288747.1	521	Silent Mutation	AAC,AAT	N99N	NP_001275676.1
NM_001363.4	521	Silent Mutation	AAC,AAT	N99N	NP_001354.1

Gene: MIR664B
Gene Name: microRNA 664b

There are no transcripts associated with this gene.

Gene: SNORA36A
Gene Name: small nucleolar RNA, H/ACA box 36A

There are no transcripts associated with this gene.

Gene: SNORA56
Gene Name: small nucleolar RNA, H/ACA box 56

There are no transcripts associated with this gene.

View Full Product Details