Product Details

SNP ID: rs2766
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:24216939 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AAGCACACAGGACTGCAAACTAACA[C/T]CCAGTAGCCAGCAAGGGCCCTCTGG
Phenotype: MIM: 610051 MIM: 603171 MIM: 610711
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CHMP4A PubMed Links

Gene Details

Gene: CHMP4A
Gene Name: charged multivesicular body protein 4A

There are no transcripts associated with this gene.

Gene: MDP1
Gene Name: magnesium dependent phosphatase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001199821.1		Intron			NP_001186750.1
NM_001199822.1		Intron			NP_001186751.1
NM_138476.3		Intron			NP_612485.2

Gene: NEDD8
Gene Name: neural precursor cell expressed, developmentally down-regulated 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006156.2		Intron			NP_006147.1

Gene: NEDD8-MDP1
Gene Name: NEDD8-MDP1 readthrough

There are no transcripts associated with this gene.

Gene: TSSK4
Gene Name: testis specific serine kinase 4

There are no transcripts associated with this gene.

View Full Product Details