Product Details

SNP ID: rs2273554
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:33076440 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TCTGCCACTTTACCTCCTTGGTGTT[A/T]GTTACAGGTTGGGTACACATAATCC
Phenotype: MIM: 600367 MIM: 612296
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: CSTF3 PubMed Links

Gene Details

Gene: CSTF3
Gene Name: cleavage stimulation factor subunit 3

There are no transcripts associated with this gene.

Gene: LINC00294
Gene Name: long intergenic non-protein coding RNA 294

There are no transcripts associated with this gene.

Gene: TCP11L1
Gene Name: t-complex 11 like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145541.1	5708	Intron			NP_001139013.1
NM_018393.3	5708	Intron			NP_060863.3
XM_011520204.2	5708	UTR 3			XP_011518506.1
XM_011520205.2	5708	UTR 3			XP_011518507.1
XM_011520206.2	5708	UTR 3			XP_011518508.1
XM_011520207.2	5708	UTR 3			XP_011518509.1
XM_017017989.1	5708	UTR 3			XP_016873478.1
XM_017017990.1	5708	UTR 3			XP_016873479.1
XM_017017991.1	5708	UTR 3			XP_016873480.1
XM_017017992.1	5708	UTR 3			XP_016873481.1

View Full Product Details