Product Details

SNP ID: rs3752203
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:2337287 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCAGGGTCCGGCTGTGGGAGCTGCA[A/G]TAGGGATGGCTCTGCCTAGGTGGGC
Phenotype: MIM: 607287 MIM: 608239
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LSM7 PubMed Links

Gene Details

Gene: LSM7
Gene Name: LSM7 homolog, U6 small nuclear RNA and mRNA degradation associated

There are no transcripts associated with this gene.

Gene: SPPL2B
Gene Name: signal peptide peptidase like 2B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001077238.1	410	Intron			NP_001070706.1
NM_152988.2	410	Intron			NP_694533.1
XM_011528138.2	410	Intron			XP_011526440.1
XM_011528139.1	410	Intron			XP_011526441.1
XM_011528140.1	410	Intron			XP_011526442.1
XM_017027016.1	410	Intron			XP_016882505.1
XM_017027017.1	410	UTR 5			XP_016882506.1
XM_017027018.1	410	Intron			XP_016882507.1
XM_017027019.1	410	UTR 5			XP_016882508.1

View Full Product Details