Product Details

SNP ID: rs12975695
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:13884988 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GCTGCATTGGCCCTGGGACGCTGTC[A/G]GAGATTCAGATGTGAACCCTCCCGG
Phenotype: MIM: 608229
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: C19orf57 PubMed Links

Gene Details

Gene: C19orf57
Gene Name: chromosome 19 open reading frame 57

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024323.3	2491	Intron			NP_077299.3
XM_006722885.3	2491	Intron			XP_006722948.2
XM_011528286.2	2491	UTR 3			XP_011526588.1
XM_011528287.2	2491	UTR 3			XP_011526589.1
XM_017027300.1	2491	Intron			XP_016882789.1
XM_017027301.1	2491	Intron			XP_016882790.1

Gene: MIR181D
Gene Name: microRNA 181d

There are no transcripts associated with this gene.

Gene: NANOS3
Gene Name: nanos C2HC-type zinc finger 3

There are no transcripts associated with this gene.

View Full Product Details