Product Details

SNP ID: rs12617942
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:232551358 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCAAGACCTAAGTATACTTGTTGCC[C/T]TCTCCTGCCCGCTCCGGTTTCTAGT
Phenotype: MIM: 100730 MIM: 605895 MIM: 612972
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CHRNG PubMed Links

Gene Details

Gene: CHRNG
Gene Name: cholinergic receptor nicotinic gamma subunit

There are no transcripts associated with this gene.

Gene: EIF4E2
Gene Name: eukaryotic translation initiation factor 4E family member 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001276336.1		Intron			NP_001263265.1
NM_001276337.1		Intron			NP_001263266.1
NM_001282958.1		Intron			NP_001269887.1
NM_004846.3		Intron			NP_004837.1
XM_005246975.3		Intron			XP_005247032.1
XM_011512206.2		Intron			XP_011510508.1
XM_017005377.1		Intron			XP_016860866.1

Gene: MIR5001
Gene Name: microRNA 5001

There are no transcripts associated with this gene.

Gene: TIGD1
Gene Name: tigger transposable element derived 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_145702.2		Intron			NP_663748.1

View Full Product Details