Product Details

SNP ID: rs1811338
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.12:101749532 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: AGTTTCTTGATAAATACTTCCTGCG[G/T]ATATGGAGAGATGAACAAGATGAAG
Phenotype: MIM: 616747 MIM: 607840 MIM: 604759
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: CHPT1 PubMed Links

Gene Details

Gene: CHPT1
Gene Name: choline phosphotransferase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_020244.2		Intron			NP_064629.2
XM_011538574.1		Intron			XP_011536876.1
XM_011538575.1		Intron			XP_011536877.1

Gene: GNPTAB
Gene Name: N-acetylglucosamine-1-phosphate transferase alpha and beta subunits

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024312.4		Intron			NP_077288.2
XM_006719593.2		Intron			XP_006719656.1
XM_011538731.2		Intron			XP_011537033.1
XM_017019961.1		Intron			XP_016875450.1
XM_017019962.1		Intron			XP_016875451.1

Gene: SYCP3
Gene Name: synaptonemal complex protein 3

There are no transcripts associated with this gene.

View Full Product Details