Product Details

SNP ID: rs10419971
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:35766070 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GTATTCACAGGCTCCCTCTGGCTGA[A/G]AGTAGGGAACAGATTTGGAGGAGAG
Phenotype: MIM: 614902 MIM: 610695
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ARHGAP33 PubMed Links

Gene Details

Gene: ARHGAP33
Gene Name: Rho GTPase activating protein 33

There are no transcripts associated with this gene.

Gene: HSPB6
Gene Name: heat shock protein family B (small) member 6

There are no transcripts associated with this gene.

Gene: PROSER3
Gene Name: proline and serine rich 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039887.2		Intron			NP_001034976.2
XM_011526528.1		Intron			XP_011524830.1
XM_011526529.2		Intron			XP_011524831.1
XM_011526530.1		Intron			XP_011524832.1
XM_011526531.1		Intron			XP_011524833.1
XM_011526532.1		Intron			XP_011524834.1
XM_011526533.2		Intron			XP_011524835.1
XM_011526534.1		Intron			XP_011524836.1
XM_011526535.2		Intron			XP_011524837.1
XM_011526536.2		Intron			XP_011524838.1

View Full Product Details