Product Details

SNP ID: rs1045018
Assay Type: DME
NCBI dbSNP Submissions: NA
Location: Chr.5:132369935 on Build GRCh38
Set Membership: DME Validated Inventoried
Context Sequence [VIC/FAM]: CACGCGCAAAGCCCGCCGCGTTCCC[A/C]GACCCCAGGCCGCGCTCTGTGGGCC
Phenotype: MIM: 603377
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: LOC553103 PubMed Links

Gene Details

Gene: LOC553103
Gene Name: uncharacterized LOC553103

There are no transcripts associated with this gene.

Gene: MIR3936
Gene Name: microRNA 3936

There are no transcripts associated with this gene.

Gene: SLC22A5
Gene Name: solute carrier family 22 member 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001308122.1	227	UTR 5			NP_001295051.1
NM_003060.3	227	UTR 5			NP_003051.1
XM_011543590.2	227	Intron			XP_011541892.1
XM_017009778.1	227	Intron			XP_016865267.1

View Full Product Details