Product Details

SNP ID: rs6500628
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:4696590 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTCATTCCTAAGGTCCCACCTCAG[A/T]TGGCACCTGTGCGTGTATATGGATA
Phenotype: MIM: 607559
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: ANKS3 PubMed Links

Gene Details

Gene: ANKS3
Gene Name: ankyrin repeat and sterile alpha motif domain containing 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242929.1	2252	UTR 3			NP_001229858.1
NM_001308089.1	2252	UTR 3			NP_001295018.1
NM_001324129.1	2252	UTR 3			NP_001311058.1
NM_001324130.1	2252	UTR 3			NP_001311059.1
NM_133450.3	2252	UTR 3			NP_597707.1
XM_005255119.3	2252	UTR 3			XP_005255176.1
XM_005255121.3	2252	UTR 3			XP_005255178.1
XM_011522372.1	2252	UTR 3			XP_011520674.1
XM_011522373.1	2252	UTR 3			XP_011520675.1
XM_011522374.1	2252	UTR 3			XP_011520676.1
XM_011522378.1	2252	UTR 3			XP_011520680.1
XM_017022935.1	2252	UTR 3			XP_016878424.1
XM_017022936.1	2252	UTR 3			XP_016878425.1

Gene: MGRN1
Gene Name: mahogunin ring finger 1

There are no transcripts associated with this gene.

Gene: NUDT16L1
Gene Name: nudix hydrolase 16 like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001193452.1	2252	Intron			NP_001180381.1
NM_032349.3	2252	Intron			NP_115725.1
XM_005255633.4	2252	Intron			XP_005255690.1

View Full Product Details