Product Details

SNP ID: rs1865434
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.13:109756261 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: TGCTGAGCGTCTTCTTTTAATGATA[C/T]TCTCTGACATGTGACATCCTGGTGA
Phenotype: MIM: 600797
Polymorphism: C/T, Transition Substitution
Allele Nomenclature
Literature Links: IRS2 PubMed Links
Additional Information: For this assay, SNP(s) [rs74123739] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003749.2	4574	UTR 3			NP_003740.2