Product Details

SNP ID: rs13302
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:74153269 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CGCTCTTTGGGCCTGATTTGTTAAT[A/G]CTTATGAGGTAATGATATTATGTTT
Phenotype: MIM: 613183 MIM: 609281
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: BOLA3 PubMed Links

Gene Details

Gene: BOLA3
Gene Name: bolA family member 3

There are no transcripts associated with this gene.

Gene: BOLA3-AS1
Gene Name: BOLA3 antisense RNA 1 (head to head)

There are no transcripts associated with this gene.

Gene: MOB1A
Gene Name: MOB kinase activator 1A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001317110.1	4240	UTR 3			NP_001304039.1
NM_001317111.1	4240	UTR 3			NP_001304040.1
NM_001317112.1	4240	UTR 3			NP_001304041.1
NM_018221.4	4240	UTR 3			NP_060691.2
XM_011532948.2	4240	UTR 3			XP_011531250.1

View Full Product Details