Product Details

SNP ID: rs14609
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:2059971 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCAGCTGGGGAGAGAATCTTAAAGG[A/G]GAGGCCGGGGACCCTGTACTCCAAA
Phenotype: MIM: 603825 MIM: 610016 MIM: 613487 MIM: 610963
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HIC1 PubMed Links

Gene Details

Gene: HIC1
Gene Name: hypermethylated in cancer 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001098202.1	6034	Intron			NP_001091672.1
NM_006497.3	6034	Intron			NP_006488.2

Gene: MIR132
Gene Name: microRNA 132

There are no transcripts associated with this gene.

Gene: MIR212
Gene Name: microRNA 212

There are no transcripts associated with this gene.

Gene: SMG6
Gene Name: SMG6, nonsense mediated mRNA decay factor

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001256827.1	6034	UTR 3			NP_001243756.1
NM_001256828.1	6034	UTR 3			NP_001243757.1
NM_001282326.1	6034	UTR 3			NP_001269255.1
NM_017575.4	6034	UTR 3			NP_060045.4
XM_005256569.3	6034	UTR 3			XP_005256626.1
XM_005256570.3	6034	Intron			XP_005256627.1
XM_005256571.4	6034	UTR 3			XP_005256628.1
XM_011523769.2	6034	UTR 3			XP_011522071.1
XM_011523772.2	6034	Intron			XP_011522074.1
XM_011523773.2	6034	Intron			XP_011522075.1
XM_011523774.2	6034	Intron			XP_011522076.1
XM_011523775.2	6034	UTR 3			XP_011522077.1
XM_017024398.1	6034	Intron			XP_016879887.1
XM_017024399.1	6034	UTR 3			XP_016879888.1

View Full Product Details