Product Details

SNP ID: rs3018301
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:72081025 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCCACCGACCCTCATCACCTTTCAC[A/G]GCGAACAAGATACAACACTCACATG
Phenotype: MIM: 612414 MIM: 164009
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: LRTOMT PubMed Links

Gene Details

Gene: LRTOMT
Gene Name: leucine rich transmembrane and O-methyltransferase domain containing

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145307.4		Intron			NP_001138779.1
NM_001145308.4		Intron			NP_001138780.1
NM_001145309.3		Intron			NP_001138781.1
NM_001145310.3		Intron			NP_001138782.1
NM_001205138.3		Intron			NP_001192067.1
NM_001271471.2		Intron			NP_001258400.1
NM_001318803.1		Intron			NP_001305732.1
NM_145309.5		Intron			NP_660352.1
XM_006718473.3		Intron			XP_006718536.1
XM_006718474.3		Intron			XP_006718537.1
XM_011544847.2		Intron			XP_011543149.1
XM_011544848.2		Intron			XP_011543150.1
XM_017017356.1		Intron			XP_016872845.1
XM_017017357.1		Intron			XP_016872846.1
XM_017017358.1		Intron			XP_016872847.1
XM_017017359.1		Intron			XP_016872848.1
XM_017017360.1		Intron			XP_016872849.1

Gene: MIR3165
Gene Name: microRNA 3165

There are no transcripts associated with this gene.

Gene: NUMA1
Gene Name: nuclear mitotic apparatus protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286561.1		Intron			NP_001273490.1
NM_006185.3		Intron			NP_006176.2
XM_006718564.1		Intron			XP_006718627.1
XM_011545054.1		Intron			XP_011543356.1
XM_011545055.1		Intron			XP_011543357.1
XM_011545056.2		Intron			XP_011543358.1
XM_011545057.2		Intron			XP_011543359.1
XM_011545058.1		Intron			XP_011543360.1
XM_011545059.2		Intron			XP_011543361.1
XM_011545060.2		Intron			XP_011543362.1
XM_011545061.2		Intron			XP_011543363.1
XM_011545062.2		Intron			XP_011543364.1
XM_011545063.2		Intron			XP_011543365.1
XM_011545064.1		Intron			XP_011543366.1
XM_011545065.1		Intron			XP_011543367.1
XM_011545066.1		Intron			XP_011543368.1
XM_017017830.1		Intron			XP_016873319.1
XM_017017831.1		Intron			XP_016873320.1

View Full Product Details