Product Details

SNP ID: rs2839716
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:41693655 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCTGCTCTCTCCACAGCACCCATGT[C/T]CAGGCCCACCTTCGGGTGTCCACAC
Phenotype: MIM: 608797 MIM: 601304
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: C22orf46 PubMed Links

Gene Details

Gene: C22orf46
Gene Name: chromosome 22 open reading frame 46

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001142964.1	494	Missense Mutation	CCA,TCA	P137S	NP_001136436.1
XM_011530373.2	494	Missense Mutation	CCA,TCA	P137S	XP_011528675.1
XM_017028939.1	494	UTR 5			XP_016884428.1

Gene: MEI1
Gene Name: meiotic double-stranded break formation protein 1

There are no transcripts associated with this gene.

Gene: SNU13
Gene Name: SNU13 homolog, small nuclear ribonucleoprotein (U4/U6.U5)

There are no transcripts associated with this gene.

View Full Product Details