Product Details

SNP ID: rs2231405
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.9:132884256 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ATGAGTCCTTCATTCGTTTCTCTAC[C/T]AAATATGTAAGTGAATAACAACAAG
Phenotype: MIM: 615365 MIM: 605284
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AK8 PubMed Links

Gene Details

Gene: AK8
Gene Name: adenylate kinase 8

There are no transcripts associated with this gene.

Gene: SPACA9
Gene Name: sperm acrosome associated 9

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001316897.1		Intron			NP_001303826.1
NM_001316898.1		Intron			NP_001303827.1
NM_001316900.1		Intron			NP_001303829.1
NM_018956.4		Intron			NP_061829.3
XM_017014231.1		Intron			XP_016869720.1

Gene: TSC1
Gene Name: tuberous sclerosis 1

There are no transcripts associated with this gene.

View Full Product Details